Męski hipogonadyzm spowodowany mutacją w genach podjednostki hormonu stymulującego pęcherzyki ad

Po dożylnym podaniu 100 .g hormonu uwalniającego gonadotropiny stężenie hormonu luteinizującego w surowicy pacjenta wzrosło z 24,5 miliona na mililitr do 66,6, 73,3, 74,5 i 70,2 miu na mililitr odpowiednio po 15, 30, 45 i 60 minutach. Stężenia hormonu folikulotropowego w surowicy wynosiły mniej niż 0,5 mIU na mililitr przed i po podaniu hormonu uwalniającego gonadotropiny. Analiza nasienia przy dwóch okazjach pokazała białe ejakulaty (2,5 i 2,9 ml) bez plemników. Wiek kości wynosił 16 lat, a wyniki badań rezonansu magnetycznego mózgu i przysadki były prawidłowe. 17-letni brat probanda miał 179 cm wzrostu i 5 włosów łonowych Tannera. Jego objętość jąder wynosiła 25 ml obustronnie. Miał normalne libido, z normalną erekcją i wytryskami. Jego hormon stymulujący folikulotropinę, hormon luteinizujący i stężenie testosteronu wynosiły odpowiednio 3,3 miliona na mililitr, 5,7 mililitra na mililitr i 1020 ng na decylitr (35,4 nmola na litr).
Ojciec, który miał 41 lat, miał normalne libido i funkcje seksualne. Jego włosy łonowe były stadium Tannera 5, a jego objętość jąder wynosiła 25 ml obustronnie. Jego stężenie hormonu folikulotropowego w surowicy, hormonu luteinizującego i testosteronu wynosiło odpowiednio 3,9 mIU na mililitr, 4,7 miliona na mililitr i 990 ng na decylitr (34,3 nmol na litr). Wiek matki w okresie menarche wynosił 12,5 roku. Urodziła troje dzieci: opisanych powyżej braci i trzyletnią dziewczynkę z drugiego małżeństwa. Miała przewlekłe autoimmunologiczne zapalenie tarczycy, które było leczone tyroksyną.
Protokół badania został sprawdzony i zatwierdzony przez komitet ds. Przeglądu szpitali i uzyskano świadomą zgodę wszystkich uczestników.
Analiza DNA
DNA ekstrahowano z leukocytów krwi obwodowej standardowymi metodami. Wszystkie trzy egzony genu dla podjednostki . hormonu folikulotropowego amplifikowano za pomocą testu reakcji łańcuchowej polimerazy (PCR) z użyciem par starterów zaprojektowanych do amplifikacji eksonów i połączeń ekson-intron na podstawie sekwencja genowa.13 Zastosowane startery to FSH-1-F 5 AATTTGAGAAGGTAAAGGAG3 i FSH-1-R 5 GCATAAATTTCCTACACAAC3 dla egzonu 1, FSH-2-F 5 GGCTTCATTGTTTGCTTCC3 i FSH-2-R 5 AAACCCCGGTAATACAGAC3 w przypadku egzonu 2 i FSH-3-F 5 AACTTCCACAATACCATAACC3 i FSH-3-R 5 CAGACTTTTTGAATATCTTGG3 w przypadku egzonu 3 zastosowano FSH-3-R2 5 ACAGTACAATCAGTGCTGTCG3 zamiast FSH-3-R do analizy konformacje polimorficzne pojedynczej nici i analizy restrykcyjne.
Test PCR przeprowadzono przy użyciu 2,5 mM chlorku magnezu, 0,2 mM trifosforanu deoksynukleozydu, 0,5 uM każdego startera i jednostki polimerazy Taq (MBI Fermentas, Wilno, Litwa) z buforem producenta. Warunki cykliczne były następujące: jedna minuta w 94 ° C, jedna minuta w temperaturze wygrzewania i jedna minuta w 72 ° C przez 30 cykli, a następnie pięć minut w 72 ° C. Temperatura wyżarzania wynosiła 45 ° C dla pierwszego eksonu i 55 ° C lub 52 ° C dla drugiego i trzeciego eksonu. Produkty PCR oczyszczono przy użyciu zestawu Quiaquick do ekstrakcji z żelu (Quiagen, Hilden, Niemcy) i 3 .g DNA z trzech oddzielnych reakcji PCR (1 .g DNA z każdego) połączono i poddano sekwencjonowaniu za pomocą sekwenatora DNA ABI 310 (Perkin Elmer, Foster City, CA) w obu pasmach
[hasła pokrewne: ambrisentan, atropina, alprazolam ]
[podobne: zapalenie migdałków objawy, zapalenie nerwu twarzowego, zapalenie okostnej objawy ]